Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_489D6-3
Clone ID CMHD-GT_489D6-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_489D6-3
Sequence
TTCGCTGCACGAACTGCGCCCGGTGCGTGCCCCAGGATAAGGCCATCAAGAAGTTTGTCATTCGGAACATTGTAGAAGCC
GCTGCTGTCAGGGACATATCTGAAGCAAGCGTCTTCGACGCCTACGTGCTTCCCAAGCTCTATGTCAAGCTGCATTATTG
CGTGAGCTGTGCCATCCATAGCAAGGTTGTTAGGAATCGATCCCGCGAGGCCCGGAAGGACCGAACACCCCCACCACGAT
TCAGACCTGCTGGCGCTGCACCTCGACCTCCACCAAAGCCCATGTAAAGAGGCCGTTTTGTAAGGACGGAAGGAAAATTA
CCCTGGAAAAATAAAATGGAAGTTGTACTTT
Sequence Type mRNA
Unitrap ID UNI14925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 128061593..128063238 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025362 (AC117232.3) NM_013765 40S ribosomal protein S26 [Source:UniProtKB/Swiss-Prot;Acc:P62855]

 
Come back to gene ENSMUSG00000025362


For any suggestions or comments, please send an email to unitrap@crg.es