Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_453B8-3
Clone ID CMHD-GT_453B8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_453B8-3
Sequence
CTCAGCAGCACAACATACCCTGGTGGTTGTGAAGATGGGCCACGCACATTCTGGGATGGGCAAGGTCAAGGTAGACAACC
Sequence Type mRNA
Unitrap ID UNI23397

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20442372..20443034 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037217 (Syn1) NP_038708 synapsin I Gene [Source:MGI (curated);Acc:Syn1-001]

 
Come back to gene ENSMUSG00000037217


For any suggestions or comments, please send an email to unitrap@crg.es