Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_453B7-3
Clone ID CMHD-GT_453B7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_453B7-3
Sequence
CCCCGTGCCGATCCCATTCCAATATGTAGCTTCTGTTTGGGGACTAAAGAGTCAAATCAAGAAAAAAAACCAAAAAAACT
CCTGTCTTGTGCAGATTGTGGCAATAGTGGACACCCATCCTGTCTGAAGTTTTGTCCTGAGTTAACCGCAAATGTGAAGG
CCTTGAGGTGGCAGTGCATCGAGTGCAAGACGTGCAGCGCATGTCGAGTCCAGGGCAAAAATGCAGATAACATGCTTTTT
TGTGATTCCTGTGATAGAGGATTCCATATGGAGTGCTGTGACCCACCACTTTCCAGAATGCCAAAAGGGATGTGGATTTG
CCAAGTCTGCAGACCAAAGAAAAAAGGAAAAAAACTACTATCATGAGAAAGCTGCACAAATAAAACAAACAATATGCAAA
ACCCATTGGACGACC
Sequence Type mRNA
Unitrap ID UNI16457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22428976..22441282 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]

 
Come back to gene ENSMUSG00000021767


For any suggestions or comments, please send an email to unitrap@crg.es