Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_461D9-3
Clone ID CMHD-GT_461D9-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_461D9-3
Sequence
TTGTTTGCAGTTACCAGCTTCAGAAAATGTCAGCATGAGGTTATGCAATGGTCTCTGCAAGATGTTTTATTCTTGAATTG
GAACCTTTTACGACTGACAAATGCTGGTACTTTATCTCCTATAAGTGGACTATAATTTCTTTTCTTAAGACAACTACATA
AGC
Sequence Type mRNA
Unitrap ID UNI15532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12630438..12671173 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es