Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_461B10-3
Clone ID CMHD-GT_461B10-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_461B10-3
Sequence
ATTTTGCTGGAAGAACTTGCCAGTAGCGATCCCAAGTTAGCCCTCACTGGAGTCCCTATAGTACAGTGGCCAAAAAGGGA
TAAGCTTAAATTCCCTACCAGGCCAAAGGTGAGGGTTCCTACAATTCCCATCACAAAGCCTCACACCATGAAGCCAGCTC
CACGCTTAACACCTGTAAGGCCTGCTGCAGCCTCCCCCATTGTGTCAGGAGCCAGGCGGAGAAGAGTGCGGTGCAGGAAA
TGCAAAGCTTGTGTGCAAGGAGAATGTGGAGTCTGCCACTACTGCAGGGACATGAAGAAATTTGGTGGACCTGGACGCAC
GAAGCAATCCTGTGTCCTCCGACAGTGCTTAGCACCCAGACTGCCTCATTCAGTTACGTGTTCTCTCTGTGGAGAAGTAG
ATCAGAATGAAGAGACCCAGGAAAAAAAAAAAAAAAAAAAAAAAAAACTGCCTCTGCTTTTATATACTTAAAAAAAAAAT
GCCTCCAGATGGATGGAGAGGGGTTGCTGAACGAGGAATTGCCAAATTGCTGGGAGTGTCCAAAGTGTTACCAGGAAGAC
AGCTCGGACAAAGCCCAGAAGCG
Sequence Type mRNA
Unitrap ID UNI13020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4326809..4331269 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]

 
Come back to gene ENSMUSG00000054611


For any suggestions or comments, please send an email to unitrap@crg.es