Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_421E3-3
Clone ID CMHD-GT_421E3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_421E3-3
Sequence
GGCAGTTATACGACGGCTACGATGAGGAGTATGGCTGTCCCATTCTAGATGAGGATAGGGTTGTCGATGAGTTAGAGCAT
CAGATGCAGGAGGGCGGTGTGATTGTGGATTACCACGGCTGTGACTTCTTCCCCGAACGCTGGTTTCATATAGTGTTTGT
GTTGAGAACAGATAATGGTGTATTGTATAAACGACTTGAAACAAGGGGTTATAATGAGAAGAAACTACAAGACAATATTC
AGTGTGAGATTTTTCAAGTTCTTTATGAAGAAGCCATAGCATCTTACAAAGAAGAAATCGTGCATCAGCTGCCCAGTAAT
GAACCAGAACAGCTCGAGGACAATATCAACCAAATCTCAAAATGGATTGAGCAGTGGGTCAAAGATCATAACCCTTAACT
TAGACACTGGCTAGCCAGGCACCACCTCCGTCCATCGTCCCAGATCTTAGGAGGCAGCAGCTGGTCTACACAGTGAGTTC
TAGGCCAGCCAGGGCTGCACAGTAAGGCTCTGTTTCAAAGGGAAAAAAAAAAAAAAAAAAAAGCCTGGCTACCGTCACTC
ATTCCACATAATAAGAACACGGGAGGATGAGCAGAAGAAAGCTTGTGTCGCAGCTCTAGCTGCTGCCTGGATTTCTTTTT
CTCCGTGAGAAACCTTACACAATCTCAGATATGAATATAACTTATTAAAGATTAAAAGTTGTCTTCAAATTGAATTGATA
ATAAATCTGGTCAATGG
Sequence Type mRNA
Unitrap ID UNI16543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101434005..101436313 524
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078941 (4921516M08Rik) NM_027592 Adenylate kinase isoenzyme 6 (EC 2.7.4.3)(ATP-AMP transphosphorylase 6) [Source:UniProtKB/Swiss-Prot;Acc:Q8VCP8]

 
Come back to gene ENSMUSG00000078941


For any suggestions or comments, please send an email to unitrap@crg.es