Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_476G4-3
Clone ID CMHD-GT_476G4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_476G4-3
Sequence
AGTGGGTAACTTGTCTTCGGGATTACTGTTTGATGCCTGACCCACACAGTGAAGAGGGAGCCCAGGACTATGTATCACTG
TTCAAGCACCAGATGCTGTGTGACATGAACAGAGTGCTGGAGCTGCGTCTGATTCTGCGGCAGCCATCACCACTGTGGCT
GTCTTTCACAGTGGAGGAACTGCAGATCTACCAACAGGGACCAAAGAGCCCCTCCTTGGCGTTCCCCAAGTGGCTTTCCC
ACCCAGTGTCCAATGAGCAGCCTGCTCCCCGCCTTGAGGGTCTCCCAGATCCCAGCAGAGTGTCCTCTGAGGTGCAGCAG
ATGTGGGCACTGACAGAGATGATTCGGGCTAGTCACACTTCCACGAGGATCGGCCGCTTCGACGTGGATGGCTGTTATGA
TCTGAATTTACTCTCCTACACATGAACAGCAGCTTCTACGTGAGATGTTGGCTTTCTGTGCCCATCTAGATGGGGTTTGG
CCACCAGAGGCCGTTCCCTGTGCATCCAAGTTCTATCTGGGCAAAAATCTGCAGATTGGGAATTCTTGATACCCATCCAG
TTGTTTTAGCATGAATTCCTAGTGGGGGCACTTCTGTCTCTGACTGTCTGACATGTAAATTCAGTCTCTTCCTCTCAGAA
TTCACCGGTTCTAATTAGAATCCTTGAGCTCCTCTTGCTTGTCCTGCCAACACGAACACCCCAGTCTGCTACCATTTCCC
CCCATTGCTGAGATAAACCTGTCACTT
Sequence Type mRNA
Unitrap ID UNI23258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108195752..108197762 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032606 (Nicn1) NM_025449 nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]

 
Come back to gene ENSMUSG00000032606


For any suggestions or comments, please send an email to unitrap@crg.es