Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_476E2-3
Clone ID CMHD-GT_476E2-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_476E2-3
Sequence
GAACAGCTTTCTCAAGTTCTGGATGCCATGTTTGAAAAGATTGTCAAAACTGACGAGCATGTCATTGACCAAGGCGACGA
CGGGGACAACTTTTATGTCATAGAACGGGGAACCTATGACATTTTAGTAACGAAAGATAATCAAACACGTTCTGTTGGTC
AGTATGACAACCGTGGCAGTTTTGGAGAACTAGCTCTGATGTACAATACCCCGAGAGCTGCTACCATCATCGCCACCTCA
GAAGGCTCCCTTTGGGGATTGGACCGGGTGACTTTTAGAAGAATCATAGTGAAAAACAAAG
Sequence Type mRNA
Unitrap ID UNI8427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108630505..108642803 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032601 (Prkar2a) NM_008924 protein kinase, cAMP dependent regulatory, type II alpha Gene [Source:MGI Symbol;Acc:MGI:108025]

 
Come back to gene ENSMUSG00000032601


For any suggestions or comments, please send an email to unitrap@crg.es