Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_476H10-3
Clone ID CMHD-GT_476H10-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_476H10-3
Sequence
TTTTCAACATGGATTCCCGTGAATTCCGGAGGAGAGGCAAGGAGATGGTGGATTATATAGCTGACTATCTGGATGGCATT
GAGGGTCGTCCAGTGTACCCTGATGTGGAGCCTGGCTATCTTCGGCCCCTGATCCCTGCCACTGCCCCCCAGGAGCCAGA
AACATACGAGGACATAATCAAAGACATCGAGAAGATAATCATGCCAGGGGTGACACACTGGCACAGTCCCTATTTCTTCG
CTTACTTCCCCACGGCTAGCTCATACCCAGCTATGCTTGCAGACATGCTGTGTGGTGCTATTGGCTGCATTGGTTTCTCC
TGGGGGGAGAACAAAATGCTGTAACCTGAATCCTTTATAAACATTAAAAGTCTACTCAAGGGTGTGAAGAACATGCTACT
GGCATCTGGCAGCAAAGCCTGCTGTGTGATCGCAGCAGAGAATATGCAGCGGGCAGCAGGCATGCGTGAAACAGACAAGA
ACTTCTGTTCTTGGAGTGAACTTCCTTGTTTCCATCTAATCCACTCCCGAGACGACCCACTTTCCATCAGTTCACGAGCA
AGGAGCCACACAGGCTGGCTGACCCGTAAACTCCCCCACCTCTTAATATTCTCATCGTGGGTTCAGGTTTCAACATATGA
ATGTGGGAGACACACTCAAATCCCAGAAACCAAGGGATTAATTCCCCACCAAGGGTGGATTTGGGGGGCAAAAATGTGAA
CTTTTTGTTAAATTGA
Sequence Type mRNA
Unitrap ID UNI17654

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11773366..11780653 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es