Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_472D7-3
Clone ID CMHD-GT_472D7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_472D7-3
Sequence
CTTCTAGGGACCTATTAAAAGAGTTTCCGCAGCCTAAAAACCTTCTCAACAGCGTGATTGGAAGAGCCCTTGACATCTCA
CATGCAAAAGACAAGTTAGTCTATGTGCACACGAATGGACC
Sequence Type mRNA
Unitrap ID UNI20645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110001243..110001363 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]

 
Come back to gene ENSMUSG00000032480


For any suggestions or comments, please send an email to unitrap@crg.es