Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_474E4-3
Clone ID CMHD-GT_474E4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_474E4-3
Sequence
AGTTCTCATGATCTGTTTGTCCTGGATCTTCTTTCTCCTTTGCCTGGACGGGAGGGCCCTGGCAGCCCCTCAGCCTACTG
TTGTTGCTGAGGAGATATTGGAGGAGGAAACCGTGGTGGAGGAGACAGGGGTACCTGTGGGTGCCAACCCAGTCCAGGTG
GAAATGGGAGAATTTGAGGACGGTGCAGAGGAAACGGTCGAGGAGGTGGTGGCTGACAACCCCTGCCAGAACCATCATTG
CAAACATGGCAAGGTGTGTGAGCTGGACGAGAGCAACACCCCCATGTGTGTGTGCCAGGACCCCACCAGCTGCCCTGCTC
CCATTGGCGAGTTTGAGAAGGTATGCAGCAATGACAACAAGACCTTCGACTCTTCCTGCCACTTCTTTGCCACCAAGTGC
ACCCTGGAGGGCACCAAGAAGGGCCACAAGCTCCACCTGGACTACATCGGACCATGCAAATACATCGCCCCCTGCCTGGA
TTCCGAGCTGACCGAATTCCCTCTGCGCATGCGTGACTGGCTCAAAAATGTCCTGGTCACCTTGTACGAGAGAGATGAGG
GCAACAACCTCCTCACTGAGAAGCAGAAGCTGCGTGTGAAGAAGATCCATGAGAATGAGAAGCGCCTGGAGGCTGGAGAC
CACCCCGTGGAGCTGTTGGCCCGAGACTTTGAGAAGAACTACAATATGTACATCTTCCCTGTCCACTGGCAGTTTGGCCA
GCTGGATCAGCACCCTATTGATGGGTACCTGTCCCACACTGAGCTGGCCCCACTGCGTGCTCTCCTCATCCCCATGGAAC
ATTGCACCACACGTTTCTTTGAGACCTGTGA
Sequence Type mRNA
Unitrap ID UNI13068

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55209365..55223499 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018593 (Sparc) NM_009242 secreted acidic cysteine rich glycoprotein Gene [Source:MGI (curated);Acc:Sparc-002]

 
Come back to gene ENSMUSG00000018593


For any suggestions or comments, please send an email to unitrap@crg.es