Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_472H3-3
Clone ID CMHD-GT_472H3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_472H3-3
Sequence
ATTCCGACCAGGATGTAGCACTCAAACTTGCTCAAGAACGAGCTGAAATAGTTGCTAAATATGACAGACGGAGGCGACTG
TGAAATACGATCAGGACCCCGGAGTGAGGCAGATTGTCTTGAAAACAAAAACACCGAAAGATTTGGCTTTTTACATGAGG
AGGAGCTCCCATACCATAATGCAGCTGCGGACCGGCAAAAGCAACTGGAAATCGAAAGGACTTCCAAGTGGCTGAAAATG
CTGAAAAAATGGGAGAGATACAAGAACACCGAGAAGTTTCATCGACGAATTTACAAAGGAATTCCACTCCAGCTCCGAGG
TGAAGTCTGGGCTCTTCTTCTTGAGATCCCTAAAATGAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAATCCCCCTC
TTGTTCTCCCCCTTAAAAAAATAATTCCTCCCAGGACAGTGTGTGGCCTTTCTGAGCCAATTCCAGGAACCACACTTCAG
TGACCACTTCATGTGAAAGACATTTCTGAAGCTACTGAAGGTGGCCACCTTCACTCCAAATGGCATTTTGTAAATAGTAA
AAAAACCAAACTGCTTCCC
Sequence Type mRNA
Unitrap ID UNI13730

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6312101..6984083 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039046 (Usp6nl) NM_181399 USP6 N-terminal like Gene [Source:MGI (curated);Acc:Usp6nl-001]

 
Come back to gene ENSMUSG00000039046


For any suggestions or comments, please send an email to unitrap@crg.es