Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_474F9-3
Clone ID CMHD-GT_474F9-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_474F9-3
Sequence
GATGAAAATGTGATCAACTTCATCAAAGGTGGACTCTAAATTAGAACAAGTTACC
Sequence Type mRNA
Unitrap ID UNI37236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82898900..82898954 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038172 (Ttc39b) NM_027238 tetratricopeptide repeat domain 39B Gene [Source:MGI Symbol;Acc:MGI:1917113]

 
Come back to gene ENSMUSG00000038172


For any suggestions or comments, please send an email to unitrap@crg.es