Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_474A8-3
Clone ID CMHD-GT_474A8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_474A8-3
Sequence
AACGATGCCAGGACTCCAATCCTTGCCTCAGCACACCGTGTAAGAATGCTGGAACGTGCCACGTTGTGGACCATGGTGGC
ACTGTGGATTATGCCTGCAGCTGTCCCCTGGGTTTCTCTGGGCCCCTCTGCCTGACACCTCTGGACAACGCCTGCCTGGC
CAACCCCTGCCGCAATGGGGGCACCTGTGACCTGCTCACTCTCACAGAGTACAAGTGCCGCTGCCCACCAGGGTGGTCAG
GAAAATCATGTCAGCAGGCTGACCCCTGTGCCTCCAACCCCTGTGCCAATGGTGGCCAGTGCCTGCCCTTTGAGTCTTCA
TACATCTGTCGCTGCCCGCCTGGCTTCCATGGCCCCACCTGCAGGCAAGATGTTAATGAGTGCAGCCAGAACCCTGGGCT
GTGCCGCCATGGAGGCACCTGCCACAATGAGATCGGCTCCTATCGCTGTGCCTGCCGTGCCACCCATACTGGTCCCCACT
GTGAACTGCCCTATGTGCCCTGCAGCCCCTCACCCTGCCAGAATGGAGGCACCTGCCGTCCTACAGGGGACACCACCCAC
GAGTGTGCCTGCTTGCCAGGTTTTGCTGGACAGAACTGTGAAG
Sequence Type mRNA
Unitrap ID UNI10323

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26337190..26340946 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026923 (Notch1) NM_008714 Notch gene homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Notch1-001]

 
Come back to gene ENSMUSG00000026923


For any suggestions or comments, please send an email to unitrap@crg.es