Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_472E8-3
Clone ID CMHD-GT_472E8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_472E8-3
Sequence
CTCCAAGGAAGCTGCCCTGAGCACTGCTCTCAGTGAGAAGCGCACATTGGAGGGCGAGCTCCATGACCTGCGGGGGCAGG
TAGCCAAGCTTGAGGCGGCCCTGGGAGAGGCTAAGAAGCAGCTTCAGGATGAGATGCTGAGGCGAGTGGATGCTGAGAAC
AGGCTACAGACGCTGAAGGAGGAGCTTGACTTCCAGAAGAACATTTACAGCGAGGAACTGCGTGAGACCAAGCGCCGGCA
TGAGACGCGGCTTGTGGAGATCGATAACGGGAAGCAGCAAGAGTTTGAGAGCCGGCTGGCAGATGCCCTGCAGGAGCTGC
GGGCTCAGCATGAGGACCAGGTGGAACAGTATAAAAAAGAGCTAGAAAAGACATACTCCGCCAAGCTGGATAATGCCAGG
CAGTCTGCTGAGAGGAACAGCAACCTCGTGGGGGCTGCCCATGAGGAACTGCAGCAGTCTCGAATCCGCATTGACAGCCT
CTCGGCCCAGCTCAGCCAGCTCCAAAAGCAGTTGGCAGCCAAGGAGGCAAAGCTGCGTGACCTGGAGGACTCGCTGGCCC
GTGAGCGCGATACCAGCCGGCGCCTGCTGGCTGAGAAAGAGCGAGAGATGGCGGAGATGCGGGCGAGGATGCAGCAGCAG
CTGGACGAGTACCAGGAGCTGCTGGACATCAAGCTGGCCCTGGACATGGAGATCCATGCCTATCGAAAGCTGCTGGAGGG
CGAGGAGGAGAGGCTGCGCCTGTCCCCCAGCCCTACCTCGC
Sequence Type mRNA
Unitrap ID UNI14233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88288731..88292284 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es