Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_474F8-3
Clone ID CMHD-GT_474F8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_474F8-3
Sequence
CCAACGTCTCCGTGAAGTCCTGGTCCGTCGAGAGTCAGAACTCAGGTTCATGATGGATGACATTCAGCTCTGCAAGGACA
TCATGGACCTGAAGCAGGAGCTGCAGAACTTGGTCGCCATCCC
Sequence Type mRNA
Unitrap ID UNI14552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14049549..14089110 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044117 (2900011O08Rik) NM_144518 RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]

 
Come back to gene ENSMUSG00000044117


For any suggestions or comments, please send an email to unitrap@crg.es