Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_472D11-3
Clone ID CMHD-GT_472D11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_472D11-3
Sequence
TCTCTGTGGCCCGCCGGCTCATCCCCTCTGAAGGGAGTACAGACCCCGCACAGAGCAGCCCTCGGGACAAGGCCTGGGGA
CTCCTCGCTCTCAGGTTCATGCTGCCTCGGGAGACCACGAAGCAGATCTACCCTTCTTGGAACTGGGCTAAGGTGATGGC
ATAGCCTTTCTCGAGTAGGCCTGGTGCTGCAGATCTCTGGATTATCCAGCACCTTCCGCTCCCACATTAGCCTCTTGAGT
TAAGTAGTTGCTTTGTGAGTGAAAATACTTCCTTACCCGAAGTAACGAAAACTTGTTAATTGGACCAAGGCTCGACTGTT
TGACATGTTTTCTGTTTGCATTTGTAATAAAAAACATG
Sequence Type mRNA
Unitrap ID UNI37238

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 49223577..49223933 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031562 (Dctd) NM_178788 dCMP deaminase Gene [Source:MGI Symbol;Acc:MGI:2444529]

 
Come back to gene ENSMUSG00000031562


For any suggestions or comments, please send an email to unitrap@crg.es