Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_472C11-3
Clone ID CMHD-GT_472C11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_472C11-3
Sequence
CTCATCCTTAACCTGACTCAGGACGGGATCACACTACTGTTTGATGCTTTCAACCAGAGACTCAAGGTGATTGAAGTTTG
TGAGTTGACAAAAGTAAAGTTAAAGTATTGTGGAGTGCATTTTAACTCTCAGGCCATCGCTCCTACCATTGAGCAAATTG
ACCAGTCTTTTGGCGCAACCCATCCTGGAGTGTACAACTCTACTGAGCAGCTCTTCCACCTCAACTTCCGAGGACTGTCT
TTCTCTTTTCAGTTAGACTCGTGGACGGAGGCTCCCAAGTATGAGCCCAATTTTGCCCATGGTCTAGCTTCTCTTCGGAT
ACCCCATGGAGCAACTGTAAAACGAATGTACATCTATAGTGGGAACAGCCTCCAGGATACCAAGGCTCCTGTGATGCCCT
TGAGCTGTTTCCTGGGGAATGTATATGCTGAAAGTGTAGACGTTCTTCGAGATGGAACTGGACCCTCAGGGTTGCGACTT
CGCTTGCTCGCTGCAGGTTGTGGACCTGGAGTGTTAGCAGATGCCAAAATGAAAGTATTTGAGCGTGCGGTGTATTTTGG
TGATTCTTGCCAAGATGTTCTTAGCATGCTTGGCTCTCCACTCAAATTCTTCTATAAATCTGAAGACAGGATGAAAA
Sequence Type mRNA
Unitrap ID UNI6229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107758400..107770452 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es