Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_473E3-3
Clone ID CMHD-GT_473E3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_473E3-3
Sequence
CAGGGTCCTGACAGGCCACAAGAAGTCAGTTATACAGACACGAAAGTGATTGGAAATGGATCATTTGGTGTGGTATATCA
AGCCAAACTTTGTGATTCTGGAGAACTGGTTGCCATCAAGAAAGTTCTACAGGACAAGCGATTTAAGAACCGAGAGCTCC
AGATCATGAGAAAGCTAGACCACTGTAACATAGTCCGACTGCGGTATTTCTTCTACTCGAGTGGCGAGAAGAAAGATGAG
GTCTACCTTAACCTGGTGCTGGACTATGTTCCGGAGACAGTGTACAGAGTCGCCAGACACTATAGTCGAGCCAAGCAGAC
ACTCCCTGTGATCTATGTCAAGTTGTATATGTATCAGCTGTTCAGAAGTCTAGCCTATATCCATTCCTTTGGAATCTGCC
ATCGAGACATTAAACCACAGAACCTCTTGTTGGATCCTGATACAGCTGTATTAAAACTCTGTGACTTTGGAAGTGCAAAG
CAGCTGGTCCGAGGAGAGCCCAATGTTTCATATATCTGTTCTCGGTACTACAGGGCACCAGAGTTGATCTTTGGAGCCAC
TGATTACACGTCCAGTATAGATGTATGGTCTGCAGGCTGTGTGTTGGCTGAATTGTTGCTAGGACAACCAATATTTCCTG
GGGACAGTGGTGTGGATCAGTTGGTGGAAATAATAAAGGTCCTAGGAACACCAACAAGGGAGCAAATTAGAGAAATGAAC
CCAA
Sequence Type mRNA
Unitrap ID UNI20380

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38144393..38208126 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022812 (Gsk3b) NM_019827 glycogen synthase kinase 3 beta Gene [Source:MGI (curated);Acc:Gsk3b-001]

 
Come back to gene ENSMUSG00000022812


For any suggestions or comments, please send an email to unitrap@crg.es