Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_473E6-3
Clone ID CMHD-GT_473E6-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_473E6-3
Sequence
GTGTGGCCAAACGTAGACAAGTATGAGCTGTTTGAAAAGCTGGAACTTGTGAAGGGCCAGAAGCGGAAGGTGAAGGACCG
TCTGAAGGCCTACGTGCGCGACCCCTATGCTCTGGACCTCATTGACAAGCTGCTGGTGCTGGACCCCGCGCAGCGGATTG
ACAGTGACGATGCCCTCAACCACGACTTCTTCTGGTCGGACCCCATGCCCTCGGACCTCAAGGGCATGCTGTCTACTCAC
TTGACGTCTATGTTTGAGTACCTGGCACCGCCACGGCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGCAG
AAATCCCGCCACCACCAACCAGACGGAATTTGAACGTGTCTTCTGAGGCCGGAACTGGCCGGTGTTGTTCTTAGGTTAGG
AGTGGATTGCTTCCTTTGCATGGAACATGTGACATGATGGGACATTTGAGATTTTCTCCTCCAGTACATATTAACTCCCA
CCCTGGCACTGGGAACAGCTGCCTGAGTGGGCTGGGGTGGAGCTATCCTGCCTGCCCCTCTCTGGAGGTCTCAGCGTGGA
CACAAAGTGAGGTGGGAGAGGCTCACCCACTGTGACTTTCTAAGAACTACTTGCATGGTGGGAGGAAGGCACAGGTCCCT
CGCCATCGCCAGCTCTTCCTCTGGATGAGAGTTTGAGGGACAGAGGCGCCTCCAAAATGGGCTACTTTTGGTCTGGACCT
TAGGGGCGTGGGGCTGTGTGAACTCCTGGTTCCTTTAAAAGGAGAATTTTATTTTGTTTTGTTAAGTTTAGAGACATTCC
TGGACGCAGTTTGATTGGTTAAATTAAAAGTTGGTTATTTTTTTCC
Sequence Type mRNA
Unitrap ID UNI37248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32562964..32563809 846
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009555 (Cdk9) NM_130860 cyclin-dependent kinase 9 (CDC2-related kinase) Gene [Source:MGI (curated);Acc:Cdk9-001]

 
Come back to gene ENSMUSG00000009555


For any suggestions or comments, please send an email to unitrap@crg.es