Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_476G5-3
Clone ID CMHD-GT_476G5-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_476G5-3
Sequence
AGGACAGAAAAATGGTCCGCATTGTCCTGACAAAAACCAAGAGAGATGCAGCAAACTGTTGGACTTCTCTTTTAGAGTCT
GAATATGCAGCTGACCCCTGGGTGCAAGACCAAATGCAGAGAAAACTTACATTAGAGCGATTCCAGAAAGAAAATCCTGG
TTTTGACTTTAGTGGAGCAGAAATCTCAGGGAACTACACGAAGGGCGGACCAGATTTCTCAAACCTTGAGAAATGACTGC
TATTGCTTAGTGTTTCTCTGTCTCGTGGATCCCGGCAGGTGCTGGCAACTTAATGCAGTTGATGAGGAGAAGGATGGAGC
AGCCAGTGTCTACAGTTAAAGATTGCCAAGTGTATTTCAATATGGTTGTAAAGATCACATTCAGATATGGTTTGCACAGG
AGGCAGAGCAGCTCTAATGTGGATAGATGATAACTTTTACTGCTCTGCAGTAAGTTTTATAGGCTACATTTTCCTAATTT
CATATTTAATTGTATTTTTACTACAAAAAACATTGGAGTACAAATCATATGAAATGAAAAAGGTGCCTTCATGGAAAAAT
ATTTTTTTTGTATGTGTGTGATATAAAAATAATGTTGAGTAAATTTCTGAGTAAGAGTTGTATACCCTTTGTCTAAATAT
GCTTGTCTGTTCACGGAAAGGACAGAACTGGAAATTTTAAGAAAGGAAAAAAATTACACTGAAGTACTTTGGATAACTTG
AGTTAATGA
Sequence Type mRNA
Unitrap ID UNI13175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40549995..40553237 575
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020328 (Nudcd2) NM_026023 NudC domain containing 2 Gene [Source:MGI (curated);Acc:Nudcd2-001]

 
Come back to gene ENSMUSG00000020328


For any suggestions or comments, please send an email to unitrap@crg.es