Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_476G1-3
Clone ID CMHD-GT_476G1-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_476G1-3
Sequence
GTTCTTGGCTAAAACCTGGACGGGGCTCGACTAGCAAGGGAAAGAACCATTTGCTGTTTTTCCTGGCTCTGAAGTGGAAG
ATGTCTGCAGACAGTCAAAGCATCGCGGCTACTGAGAACGAGGAGAAATCCCATGAGGTCACTGGTAGGCTCGAAGGAGA
TAATGAGTGTGTGAGTCGTCTGTAAGCAGTTTGTGAGCCTGTAACTGATGACTCCTGTGGTCCATGAAGCGAGAACACCC
AGAACTACCAGACCAAGTCAGCGGGACTGGGATCCTCCCACCTAGTTCTGTTGGTGTTATAACTATTAATAAATATACAC
TGGTAC
Sequence Type mRNA
Unitrap ID UNI12968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23721717..23722541 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]

 
Come back to gene ENSMUSG00000062012


For any suggestions or comments, please send an email to unitrap@crg.es