Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_471E12-3
Clone ID CMHD-GT_471E12-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_471E12-3
Sequence
GGAGCAGCGTATCGCAGAGTGCATGGCCAAGATGCCACAAATGATTGAAAACTGGCGAAAGCAGAAGCGAGAACGCTGGG
AGAAAATTCAGGCTGACAAGGAGCGGAGGGCCCGGTTACAGGCTGAGGCCCAGGAACGCCTGGGCTACCACGTGGACCCA
AGGAGTGCTCGCTTCCAGGAACTATTACAGGACCTAGACAAGCAGCAACGAAAGCGCCTAAAGGAAGAAAGACAACGACA
GAAGAAGGAGGCACGAATTGCTGCTATGGCCTCTGCTGAAGCCCAGGACTCAGCAGTGTCTGGTGAACCCAGCTCCTGAA
AGCTCCCTTCCCAATAAAGCCAGCTGCTGACAACCCAT
Sequence Type mRNA
Unitrap ID UNI10600

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87358007..87358364 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033751 (Gadd45gip1) NM_183358 growth arrest and DNA-damage-inducible, gamma interacting protein 1 Gene [Source:MGI (curated);Acc:Gadd45gip1-001]

 
Come back to gene ENSMUSG00000033751


For any suggestions or comments, please send an email to unitrap@crg.es