Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_471F5-3
Clone ID CMHD-GT_471F5-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_471F5-3
Sequence
GGTCCGCAAGCAGGTGGTGAACATCCCATCCTTTATTGTTCGCCTGGACTCGCAGAAGCACATCGACTTCTCCCTCCGTT
CTCCTTATGGTGGCGGCCGTCCAGGCCGAGTGAAGAGGAAGAATGCCAAGAAAGGCCAGGGCGGGGCTGGAGCTGGTGAT
GATGAGGAAGAGGATTAATTCTTGGCTGAACTGGAGGATTGTCTAGTTTTCCAGCTGAAAAATAAAAAAGAATTGATACT
TGG
Sequence Type mRNA
Unitrap ID UNI23611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3658253..3658499 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006333 (Rps9) NM_029767 ribosomal protein S9 Gene [Source:MGI (curated);Acc:Rps9-001]

 
Come back to gene ENSMUSG00000006333


For any suggestions or comments, please send an email to unitrap@crg.es