Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_470H6-3
Clone ID CMHD-GT_470H6-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_470H6-3
Sequence
GGCCTGAAGAAGATATCTGACTACATGAAGAGCAGCCGCTTCCTCTCCAAGCCAATCTTTGCAAAGATGGCCTTTTGGAA
CCCAAAGTAGGATTACAAAGCCCAGACCTGGGGGAATACTCATGAGTGCTCTGCTGTGCTACCACTGCTTAACGTGCAGC
TTTCTTCTCCTTTCCATTCCCTATTCCTCCATTTCCTCTTCCCATCCCTTCCCTCAGCCAAGCCTCTGGGTCCTTGGGCT
CTCCATTTCTTCATTAGTCTCCTCCTATCCCTTGTCTCTGCCCTGCATCCAGCCCTTCCCTCAGTGATGGTTGGAGGAAT
GTACTAGACCCGAGAATCCCCGGCCTGGCCTGAGAGATTAGATCTGTCTGTGTGCTGCCTTGGTCCTCAGAGTAAGCAGC
TAAGCCCCATTTGGTTCTCAATAAAGTGTGAATCAC
Sequence Type mRNA
Unitrap ID UNI29065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 107784621..107785056 411
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040562 (Gstm2) NM_008183 glutathione S-transferase, mu 2 Gene [Source:MGI (curated);Acc:Gstm2-001]

 
Come back to gene ENSMUSG00000040562


For any suggestions or comments, please send an email to unitrap@crg.es