Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_466F10-3
Clone ID CMHD-GT_466F10-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_466F10-3
Sequence
GCATTTCATGCAATGGCGACCCTTCTCCCGGATCTACAGACACCCACGAAGAGGAGGACTCCCCACCATTGCCTCTGGGA
CCCCCAATCCCTGGTGATCCCTGGCCTGGGGCGCCTCCTTTGTTTGATGAACCTCCGCCTCCAGGCTCCAACCGTCCCTG
GAGAGATCTTCCTGACAGTGGTGCCTGGCCCCCAAAGCCCCCAAGCACTGATCCCCCTAAACCTCCTCTGCCTGATGACC
CCTGGCCAGCAGGAACCCAGCCCCCAGAAAACCCCTGGCCTCCTGCCCCTGAGATGGACCATGAATCTCAGGAGGAGCCA
GACCTTGACCCACCCCAGGAAGAGTATAGATAGGGGACCCTAAGGAACGTGAGCCTCCACAGAGCACACCAAAGCCCACC
TTTTTCATTGGCTGCCCGCTTAGAATCTCAATTTTCCCTAATCCCTTAGTTCCCTTCCTCAGTCTCTGTTTGAATTGTGT
TCTATGTTGGAAGTGTCTATGCTCTGCAACCCCCCCTCCCTCCACTTTGTGGTCCCTGTTCAGTCATTATGTTGTCCCTT
CGCTTCTCTTGATCAGCAGAAAGCACACTCCTACCTCACTCAGCCTGTTCTTGCTTGTCTAGACCTGGACTTCTAGGCAG
AGCCTGAGCTCTGTGCTCTCTGCTGCCCCCTGGTTTTCTTAGCTGGGAACTGACAGTCGATCAGGATGGTGCTTCCAATG
GAAAAATAAAAGCCACGTTTTCTTCTG
Sequence Type mRNA
Unitrap ID UNI28708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35670844..35671590 743
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024409 (Psors1c2) psoriasis susceptibility 1 candidate 2 (human) Gene [Source:MGI Symbol;Acc:MGI:1930025]

 
Come back to gene ENSMUSG00000024409


For any suggestions or comments, please send an email to unitrap@crg.es