Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_466E9-3
Clone ID CMHD-GT_466E9-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_466E9-3
Sequence
GATCGGAATGCGGGGTCGGGAGCTAATGGGCGGCATTGGGAAAACCATGATGCAGAGTGGCGGCACGTTTGGCACTTTCA
TGGCCATTGGAATGGGCATACGATGCTAATTAGGGCTAGGATGCCCTGCAATACCTAAACTTCCCCATCCATTTCGACCC
TTGTACAATAATAAAGTTGTTTTCTTCTCGC
Sequence Type mRNA
Unitrap ID UNI18617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155971338..155971527 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067847 (2010100O12Rik) NM_025946 reactive oxygen species modulator 1 Gene [Source:MGI Symbol;Acc:MGI:1914317]

 
Come back to gene ENSMUSG00000067847


For any suggestions or comments, please send an email to unitrap@crg.es