Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_467C8-3
Clone ID CMHD-GT_467C8-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_467C8-3
Sequence
GAACAGCGCCTGACTGAGATGGAATGTTCTCAGGACCAGCTGAGGGATAGCCTCCAAAGCCTGCAACTTCTTTCAAAAAC
ACCAGGATCTCGGAGCCAGCCCCTGGCCTCTCAAAGCACCATGTGTCAATGGAGCTGATCTGTCAATGGGCACTTGAGCA
TTTCACCCCACTCCATATATGGTCTGGAAGCCAAGAGAGCCACTACAGAGGATTTTCTGACTGCCTCAGCCCTTCATGGC
CTTCAGTGGGGGACAGAGTGGGAGGTGTCAATCACTCTGGTAACTGTGAGGTTGCCCAGTAAATCCATTTCAGAAAATCA
AAAAAAAAAAAAAAAAAAAAAAATGATTATTACTTAGAATGCCCAAATATAAAATCAGGTCTCCCAAATTCATACCTAAT
TTGAAGTCTCCTGAAGTTGGAAATAATGAGCAGATCCTCACAATTGGTGTGATCTAAGGTTGTCACTTTAAGAGACTCCA
TTCTCTCCTCTGTAAAGTGTATCTAAAAATTCTCCACATAGTGGAAAACTCTTAGTTAAAGGTATTCAATAAAGGGTATT
GATCATTTTTGAGGGG
Sequence Type mRNA
Unitrap ID UNI28486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32527606..32528180 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052142 (A430107D22Rik) NM_178785 RIKEN cDNA A430107D22 gene Gene [Source:MGI Symbol;Acc:MGI:2444128]

 
Come back to gene ENSMUSG00000052142


For any suggestions or comments, please send an email to unitrap@crg.es