Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_470A9-3
Clone ID CMHD-GT_470A9-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_470A9-3
Sequence
GTTCATTCCGACCAAAGGGAGATGGCCCTGAAGATGATGAAGCTGGTGACCAAGCAGGAGTAACTGAGCTGGCTGGCCCT
GGAGGCGCTAAGAGCAGAGCCCAGGATGCAGGTGCTAATGTCTATCCCTGGTGCTCTTCTCCCCCGCTCTGCCATGGGAT
ATGACTCTGGGAGCACCTGCTCTCTCCCGTACCAAAAGACTGTGGCCTTCTGTGTCTACTTAGAAATCAGTTCTGCTTCC
CAAAGAGTATTTAAAACCAGACTCATTTAATCAAAGTGAAGGGTTGCAATCGATTGGTCTCTTACTACAAAAGCAGTTGA
TAGCACATGTAAATCCCAGCACTTGAGAGGTAGAAGAAGCAAGAGGATGGATGAGAGGTTCAAACGCATCCGCAGCTACG
TCGAAAGTTCAAAAGCAGCCTATGCCAAACAGGGAGAGTCCCTGTCCCCCACCCCCACCCCCAAAAAAAAACAAAAAAAA
AAAAAAAGATTTATAGGCTAAAGCAGTGGGAGATAAAAAGAAAATACTTAAACACCCACTGAGCTGCCAACTAGGTGTCT
CTGACTACGGGTCTTTTATTTGCTACATATATATTTTTACAAAAATGAAATCCATATTGTACGCTATTTTGCTGTCTGCT
TCGTTCCCATGTCAACATGACCTGCACTTCTTTTCCCATCAATAAATGTGTTGTGATATTTTC
Sequence Type mRNA
Unitrap ID UNI14013

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88785337..88786038 658
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es