Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_470A3-3
Clone ID CMHD-GT_470A3-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_470A3-3
Sequence
CCTGGATGGAGAAGATCATGCTGCAGAGAGAACCCTGGAGGATGTTTTCCTTCGAAAGTTTATGATGGGCACCTTTCCCG
GCTGCCTGGCTGACCAGATTGTTCTGAAGCGCCGGGCCAACCAAGTGGACATCTGTGCCCTGGTCCTCAGGCAGCTGCCA
GCACACAAATTCTACTTCCTCGTGGGCTACAGTGAGACTCTGTTGTCACACTTTTACAAGTGTCCTGTGCGACTCCACCT
GCAAACTGTGCCCTCCAAGGTCGTGTACAAGTACATATAAAAAGTGCACTTTTCTCCAGTAGAGCCTACAAGGTCACAGA
GGTGCAGGAGACCAAATGCCTGTTCTCTGAGGTGGAGGCGTCAGCTCCAAGCTGCTGTTGAATAAAACCCTGATCATGTT
TTGTC
Sequence Type mRNA
Unitrap ID UNI13766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5604327..5604731 405
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020477 (Mrps24) NM_026080 mitochondrial ribosomal protein S24 Gene [Source:MGI (curated);Acc:Mrps24-001]

 
Come back to gene ENSMUSG00000020477


For any suggestions or comments, please send an email to unitrap@crg.es