Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_502H7-3
Clone ID CMHD-GT_502H7-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_502H7-3
Sequence
GGAAGAAGTGTGCACCCAGAACTGGAGGAGTCTTCTGGATAAACAGACAGCATCTGCGAGGAGGGCCCTGTGTGAGGAAC
GATTGGTGTTGCTGCTGGTGGTTGGGAGTAGTTGTGGAAAGCAGGCCTCTGTACTTAGACCCTACAGAGTTGCTTTGACT
GATGACTTCTAAATGGAAAACTTGAGGTTGGAAAATGAATGAAAATAGGGCCTGTCTCCCCAGCCCTTTTTCTGCCAGTA
ATGCACACTGCTCTCTTTGTAAGAGATGAGAAACTTAAGTTCACCCAAGGGATGGTTTCAGGGACTGAGGTGTGGGTGTG
TTCTATATTCCAAATTAACTAGGCCTATCTGGTTTCTTTCACTTGAAACTAGAGAATCTGTTTGCCAAACTTCTTGATCT
TGGGAGCCAGTAGACTGGTTCTTCACTTTACCTACCGTATGCTAAGGCCCGCCCCTCACCCCTACTTTGGCCATCCGTAA
GATAGCAGGATCTTGGAGACACCGCTCCCAGCCTGAGGTCCCAAGGTTTCCTGTGCCTGCCTTGTGTGCCATCCCAACCC
ACCCTCTTGTATGCCCAGCCCTGTGCTTATGTAATTGCATTCCGGCCAGTTAATAAAGTGCCTCTTGTACAGAG
Sequence Type mRNA
Unitrap ID UNI22962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21158838..21159471 634
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057193 (Slc44a2) NM_152808 solute carrier family 44, member 2 Gene [Source:MGI Symbol;Acc:MGI:1915932]

 
Come back to gene ENSMUSG00000057193


For any suggestions or comments, please send an email to unitrap@crg.es