Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0086
Clone ID AR0086
Vector pGT0lxr
Project sanger

Sequence tag AR0086
Sequence
CGTGAGCGCATCGTGCCACGGGCTGTCCTCTACTTCACTGGGGAGGCCATAGAGGATGATGACAATTTTGAAGAAGGCGA
GGAAGGTGAAGAGGAGGAATTGGAAGGTGATGAAGAAGGAGAAGATGAGGATGATGCTGATGTTAACCCCAAG
Sequence Type mRNA
Unitrap ID UNI3564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150706289..150710131 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es