Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_513D7-3
Clone ID CMHD-GT_513D7-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_513D7-3
Sequence
TGTCCAGAGTCTTGGGTCCAGAGCAGCTTCAGGAGCTGCTGCAGATTCCAGATGATCTCACCTCACCCAGCCTTTCATAT
GGATCCAATCAGAACCTCAGTCAAGCTCTGAACTTTCCAAAACATGTGCATACTGGATAACAGATGCTAACGCTAGCTTT
CTTAAGTCTAGCCAATTTTTCTAAGTTTCCTAGCCCTGCCCACCCTTTAAAGAATCACATTGACCCTACTCAGCAGGAAG
AAGCCGTGGAAAGTCATCGTTCAGACCCCTTGGGTTTGGGCGTCTGATTATGGTGATTTTACAAATTATGGATAGATTGT
CATTTTAAGAGATAATTTGGAAATGGTCATAATTTTGAACAGGGAGAAAGTAGATGGGATGGATTACTAATTTTACTCTT
GAACAAAACATTGTGTAGCCATAATCTTACATCAATAGAAATCTTTGTAATTGATG
Sequence Type mRNA
Unitrap ID UNI37005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138426778..138427233 456
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078518 (OTTMUSG00000010069) predicted gene, OTTMUSG00000010069 Gene [Source:MGI Symbol;Acc:MGI:3651765]

 
Come back to gene ENSMUSG00000078518


For any suggestions or comments, please send an email to unitrap@crg.es