Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_502E12-3
Clone ID CMHD-GT_502E12-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_502E12-3
Sequence
CCACATAGAAAGGACTCACACTGGACACTGAGGCAGAGCTGGAACGCCAGGATGCGGCTCTGGATGGCATCACCGTAGCT
GTGGACCGGGCAACCCTGAATGTGGACAAGCAAAACCGGCGTATGAGAAAGCTGATGTAGTGGGGCAAGCTGTAAACAGC
CACCCCTGGCATGGCTCTGCTGATTCTATTGCTATTAGCCCTTTTCCTTTCCCCTGAGACCCGGGAAGCCATTCTGGGTA
CTGTGAAACTATGAGGCCCTACCTGGGAACTACACCTTCCTAGGATGGGCCAGGAGAGGCCACAATATGCATGAGCATGT
ATGTTTCCCGGGGCCCTAAGCATGAGGGCCATGTCCTGTTCAGGCAAGAATCGCCACCGTAGCGTAGCCATCCTTCCTGT
CCACACTGAGACCCCGGCGTTGAGCTGCCATTGTGGCATCATGTTGTCACATCATATTGTCATCTTTTCACCATTTTTGC
CAAACAGTAGAGAAAAATGTCAGTCATTCTGGTCTGGCTCTGCCATCCACTTGCCAGAAACATCAATTCCCCCTTCAAAT
GCTGCTGTAGCCCCTGCCACCTTTTCCTGATCATCAGTTAGAGTTCTGTAACCAGTAGCCTCTGTGTGTGCGTAATAAAA
GAATGTTTATTCGATGACT
Sequence Type mRNA
Unitrap ID UNI16029

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59220647..59221298 648
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009894 (1110031B06Rik) NM_144521 RIKEN cDNA 1110031B06 gene Gene [Source:MGI Symbol;Acc:MGI:1915076]

 
Come back to gene ENSMUSG00000009894


For any suggestions or comments, please send an email to unitrap@crg.es