Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_498C12-3
Clone ID CMHD-GT_498C12-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_498C12-3
Sequence
GATTTACGAGGGGTGCAGATCCTGGAATGCCTGAACCGTCGGTTTTAAGCCTACTTTGGGGATAAAGGACTGTTTGAACA
TCTGGATTTGGACGCGATCCAACATGGAAGGTGTATACTCCAGCTGGACAAGAAAGGAGACGTCATTTCAACGATTCTGT
GGCAGAGTGGAGGAGCCTATACTGATTTATGATAGACTATCAAAATAAATATTTTTAACAATGC
Sequence Type mRNA
Unitrap ID UNI10556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23345473..23347576 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028998 (Tomm7) NM_025394 translocase of outer mitochondrial membrane 7 homolog (yeast) Gene [Source:MGI (curated);Acc:Tomm7-001]

 
Come back to gene ENSMUSG00000028998


For any suggestions or comments, please send an email to unitrap@crg.es