Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_502A7-3
Clone ID CMHD-GT_502A7-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_502A7-3
Sequence
GGTGATACAATTCTGGAGACTGGAGAAGTAATTCCACCAATGAGAGATTTTCCTGATCAACATCATTGAAGAGTCCTTAA
AAACTTAACAGACTTGTGTAACAGCACAAGTATGTTCCTAAAGTGCTGTATTTACTGAATCTGTTTCCTGGAAAAGTAAT
TAATAAAGCTTATTCTCAGAGTGT
Sequence Type mRNA
Unitrap ID UNI14106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40217697..40217880 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071014 (Ndufb6) NM_001033305 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 Gene [Source:MGI (curated);Acc:Ndufb6-001]

 
Come back to gene ENSMUSG00000071014


For any suggestions or comments, please send an email to unitrap@crg.es