Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_466G6-3
Clone ID CMHD-GT_466G6-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_466G6-3
Sequence
ATTGAAACCCACAAGCTGACCTTCAGGGAGAATGCCAAAGCCAAGACAGACCATGGAGCAGAAATTGTGTATAAGTCACC
CGTGGTGTCTGGGGACACATCTCCACGGCACCTCAGCAATGTGTCTTCCACGGGCAGCATCGACATGGTGGACTCACCAC
AGCTTGCCACACTAGCCGATGAAGTGTCTGCTTCCTTGGCCAAGCAGGGTTTGTGATCAGGCTCCCAGGGCAGTCAATAA
TCATGGAGAGAAGAGAGAGTGAGAGTGTG
Sequence Type mRNA
Unitrap ID UNI17457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104189286..104189554 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es