Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_498F5-3
Clone ID CMHD-GT_498F5-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_498F5-3
Sequence
ACACCCAGGCAGCTGAGGCAGCAATGGAAGCCATGAAGGGCCGGCTAGCCAACCAGTACTACGAGAAGGCGGAAGAGGCC
TGGGCCCAGATGGAGGAATAACTGCCCCACAGAATCACTGCCAAGGAGAAAGGCTGGGGAAGGGAGGATGGGACTCATTT
CTAGGGAGGGGAGAAGCAGTTTTATTATGGTATAAACTCACTTTTGTATTCC
Sequence Type mRNA
Unitrap ID UNI13342

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 128046805..128047016 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035064 (Eef2k) NM_007908 eukaryotic elongation factor-2 kinase Gene [Source:MGI (curated);Acc:Eef2k-001]

 
Come back to gene ENSMUSG00000035064


For any suggestions or comments, please send an email to unitrap@crg.es