Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_477C3-3
Clone ID CMHD-GT_477C3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_477C3-3
Sequence
GACCATGGCCAACCTCGAGCGTACCTTCATTGCCATCAAGCCAGATGGCGTGCAGCGCGGCCTGGTGGGCGAGATCATCA
AACGATTCGAGCAGAAGGGGTTCCGCCTGGTGGCCATGAAGTTCCTTCGGGCCTCTGAAGAACACCTGAAGCAGCATTAC
ATCGACCTGAAAGACCGTCCTTTCTTCCCGGGGCTGGTGAAGTACATGAACTCGGGGCCCGTGGTGGCCATGGTCTGGGA
GGGGCTCAATGTGGTGAAAACGGGCCGAGTGATGCTGGGGGAGACCAATCCAGCTGATTCAAAACCAGGCACCATCCGTG
GGGATTTCTGCATTCAAGTTGGCAGGAACATCATTCATGGCAGTGATTCAGTGGAGAGTGCTGAGAAAGAGATCCATCTG
TGGTTTAAGCCCGAAGAACTGATCGACTACAAGTCTTGTGCCCATGACTGGGTGTACGAGTAGACATGAAGAAACCAGAA
TCCTTTTCAGCACTACTGATGGGTTTCTGGACAGAGCTCTTCATCCCACTGACAGGATGGATCATCTTTTCTAAAACAAT
AAAGACTTTGGAACTG
Sequence Type mRNA
Unitrap ID UNI37253

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93811130..93816938 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020857 (Nme2) NM_008705 non-metastatic cells 2, protein (NM23B) expressed in Gene [Source:MGI (curated);Acc:Nme2-001]

 
Come back to gene ENSMUSG00000020857


For any suggestions or comments, please send an email to unitrap@crg.es