Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_484D7-3
Clone ID CMHD-GT_484D7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_484D7-3
Sequence
GCTCTGACCCGACCTTGTACGGGGATGAAAAGGCCATCTTCCCGGGAGCCTTCAGCTTCAGCCACGCCGCTGGCTTCCTT
TGCAGCTGTCCTCTGGGCTTTGCTGGGAATGACTGCAGCATGGATGTGGATGAGTGTGCCTCAAGGACGTGCCTCAATGG
AGGTAGCTGCCAGGACCTGCCCAATGGATTCCAGTGCTACTGCCAGGATGGATACACAGCATGCATATCTCGACTTCAAT
AATCAAGGGGGAAAAGTTAAGGAAAAAGTGAGCTATGTGGAAGCAGCCCCCGAGAAGACCCTCTTCTGATTAGCTGCCCT
CTCTTGAGTCTCCCTTGGATGCTTCTTCAGAGAGTCTTTTTCATCTGTGATGTGGAAATTAAATATTCATTGTTATAAAA
AATATATCTCCCTTGTCAGC
Sequence Type mRNA
Unitrap ID UNI37255

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37642865..37662260 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035403 (Crb2) crumbs homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Crb2-001]

 
Come back to gene ENSMUSG00000035403


For any suggestions or comments, please send an email to unitrap@crg.es