Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_477D4-3
Clone ID CMHD-GT_477D4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_477D4-3
Sequence
GTCAGTTCACCGGGACCTGGAAGCCCAGATTGCCATCGTGACGGAGAGCCGGTCCCTGCAGCAGCAGCTTCATCAGGAGC
AAGAGCAGCTCTACCTGCGGTCTGGTGTGGTGACCTCCGCAACCTTTGAGCAGCCAGGGCGGCAGGTCAAGCTGTGGGTG
AAGATGGTGACCCCGCTAATCAAGAACTTCTTCTGAGAACAGGAATGGCCTTGATGAAGATGACGGGCATGACTGGGGTC
AGATCCTTCAACCGGGCTTCAGCAATGACTCCGGTCTGGGTGTCCCAGCGAGCTCCTGTGGGGACAATGGAGCTGAGGGT
CTGGGTGCCCTAGGGGAGGCAGAACCCACTGTTTGGATGCTGACCGTGAAAAAGGGAGGCACGGTAGGGAGAGAGGCCTG
GCCTCCAACCTCCCCACTCTTTTCAGAGACAGGCCAGTGACTGGGGAGCCATGAAGCGTTCAGGCCAGGTGCCAGGGTCT
GAGAGTGCCAAACATGGAGGAGTGTGAACCAAGGACTCCGAGGTGACTCTGCATGCCGTAATGGCTCTGAGGCTGCATCT
TCTCAGAGCTTCATCTCAGCCTTCTCAATGTCAGTGGCAGAGAAAACTGACCGCAGCTCAGATCCCAGCAATGTTCCTTC
CTGATCCCTCCTGTGTAATGTCTACTCTCTGTGTACATAGGGAATAAGTTATATATAGATGCACATATAAACACTATCTG
CCCTTAGCCAGACTGCTGTTGTCTCTTATCCTAGCCAATGGTGTTTGTGTCCTGCGTGGCATTGGAATCACAATAAACAT
Sequence Type mRNA
Unitrap ID UNI37256

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117875961..117885315 598
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017715 (Pgs1) NM_133757 phosphatidylglycerophosphate synthase 1 Gene [Source:MGI (curated);Acc:Pgs1-001]

 
Come back to gene ENSMUSG00000017715


For any suggestions or comments, please send an email to unitrap@crg.es