Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_460G8-3
Clone ID CMHD-GT_460G8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_460G8-3
Sequence
GTAGGCGAAAACCAAGAGTACATCGCGCCTCGTTCTCCAAAAAAAAAAAAAAAAAAAAAAACCACCCCTTGAATTTCCGA
ATTCCTCTGAAAATTTAATGGTGCCTAATGAGCATATAATGAATGTCATTGCCATTTATGAGGTGGTGCGGAACTTTGGC
AACGTTTTAAGGTTGTCCCCTTTTTGCTTTGAGGACTTCTGTGCGGCTCTGGTGAGCCAAGAGCAGTGCACACTCATGGC
GGAGATGCACGTGGCGCTTCTGAAAGCAGTTCTTCGAGAAGAGGACACGTCTAACACCACCTTTGGCCCTGCGGACTTGA
AAGACAGTGTAAACTCCACCCTGTATTTCATCGACGGGATGACGTGGCCGGAGGTCCTGAGGGTCTACTGTGAGAGTGAC
AAGGAGTACCACCATGTCCTTCCTTACCAGGAGGCAGAGGACTATCCCTACGGACCAGTGGAGAACAAAATCAAAGTTCT
GCAGTTTCTAGTCGATCAGTTCCTTACGACCAATATTGCTCGTGAGGAGCTGATGTCTGAAGGGGTAATCCAGTATGACG
ACCATTGTAGGGTCTGTCACAAACTTGGGGATCTGCTGTGCTGTGAGACGTGCTCGGCTGTGTACCATTTAGAGTGTGTG
AAGCCGCCTCTTGAAGAAGTGCCGGAGGACGAGTGGCAGTGTGAAGTCTGTGTGGCACACAAGGTGCCTGGTGTGACTGA
CTGTGTCGCTGAAGTCCAAAAGAATAAACCCTACGTTCGACACGAACCTATTGGGTATGACAGAAGCCGTAAGAAATACT
GGTTTT
Sequence Type mRNA
Unitrap ID UNI18463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106972146..106972949 772
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es