Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_525H1-3
Clone ID CMHD-GT_525H1-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_525H1-3
Sequence
TGCAGTTGATGGCAGTGGTGTAGAGGAAGTGAAGACAGTGCTTGTAACAACGAACCTAGCTCCTCATGGGGGTGATTTGA
C
Sequence Type mRNA
Unitrap ID UNI21290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181012653..181012722 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038705 (Gmeb2) NM_198169 glucocorticoid modulatory element binding protein 2 Gene [Source:MGI (curated);Acc:Gmeb2-001]

 
Come back to gene ENSMUSG00000038705


For any suggestions or comments, please send an email to unitrap@crg.es