Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_477C2-3
Clone ID CMHD-GT_477C2-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_477C2-3
Sequence
AATGTTGGCTTCCAGAGCGCTGAGCCTGATTGGCAAGAGAGCCATTTCTACTTCGGTGTGCCTTCGAGCACATGGGAGTG
TTGTGAAGAGTGAAGACTATGCTTTCCCCACTTACGCTGATCGGCGTGACTACCCCTTGCCTGATGTGGCCCATGTCACG
ATGCTGTCTGCCAGCCAGAAGGCGCTGAAGGAGAAGGAGAAGGCCGACTGGAGCAGCCTTTCCAGGGATGAGAAAGTTCA
GTTGTACCGCATCCAGTTTAACGAGAGCTTCGCCGAGATGAACAGGGGCACCAATGAATGGAAGACAGTTGTGGGCATGG
CCATGTTCTTCATTGGCTTCACTGCGCTCGTTCTGATTTGGGAGAAGAGCTATGTGTATGGCCCCATCCCTCATACTTTC
GATCGTGACTGGGTGGCCATGCAGACCAAGCGAATGCTGGACATGAAGGCCAACCCCATTCAGGGCTTCTCCGCCAAGTG
GGACTATGACAAGAATGAGTGGAAGAAGTGAGAGCCCGCTGCCTGCCGGCTCCCTGCCTCCCTCACTCCCTCGGCATGCT
GGAAGCTGCCGTATCCAATGGTCCATGCTAATAAAAGACCAGTTTACGTG
Sequence Type mRNA
Unitrap ID UNI11587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123193209..123198106 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031818 (Cox4i1) NM_009941 cytochrome c oxidase subunit IV isoform 1 Gene [Source:MGI Symbol;Acc:MGI:88473]

 
Come back to gene ENSMUSG00000031818


For any suggestions or comments, please send an email to unitrap@crg.es