Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_460D4-3
Clone ID CMHD-GT_460D4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_460D4-3
Sequence
GCTTTCCTTGATCGATACCTCAGTGCGGGCCCCACCTTGCAGTATGACAAGGATCGATGGCTCTCGACACAGTGGAGACT
TATTAGTGAGGAGGCTGTGACAAACGGGTTACGGGATGGAATTGTTTTCGTCCTTAAATGCTTGGACTTCAGCCTCGTGG
TCAATGTGAAGAAAATCCCATTCATTGTACTCTCAGAAGAGTTCATAGACCCTAAATCTCACAAGTTTGTTCTTCGCTTA
CAGTCTGAGACATCAGTCTAAAATTTCTATACTTGTGGCTTTATG
Sequence Type mRNA
Unitrap ID UNI36142

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101962136..101962420 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027860 (Vangl1) NM_177545 vang-like 1 (van gogh, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2159344]

 
Come back to gene ENSMUSG00000027860


For any suggestions or comments, please send an email to unitrap@crg.es