Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST418651
Clone ID OST418651
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST418651
Sequence
GACTGAGGCAGCGTTCACCGGCCATGCGGGAGCAGTACATGCGTGGGGGAGAGGGCTTCATCATCTGCTATTCTGTCACT
GACCGCCAGTCATTCCAGGAGGCTGCCAAGTTCAAGGAGCTTATTTTCCAGGTCCGTCACACCTATGAAATTCCCCTTGT
GCTAGTGGGTAACAAAATTGACTTGGAGCAGTTCCGTCAGGTATCTACAGAAGAAGGCATGAATCTTGCTCGAGACTACA
ACTGTGCCTTCTTTGAGACATCTGCAGCCCTGCGATTCGGTATCGATGATGCTTTTCAAGGCTTAGTGAGAGAAATTCGC
AGGAAGGAATCCATGCTGTCCTTGGTGGAAAGGAAATTGAAGAGGAAGGACAGCCTGTGGAAGAAGATAAAAGCCTCCCT
GAAGAAGAAGAGAGAAAACATGTTGTGAGGCTTTGCTTCCGCATCCTTCCTGTCTCTCCTTGTGGGTTTTATCAACCAGA
CAATTGTTCATATCTCCAT
Sequence Type mRNA
Unitrap ID UNI18655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 31134860..31313552 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057455 (Rit2) NM_009065 Ras-like without CAAX 2 Gene [Source:MGI Symbol;Acc:MGI:108054]

 
Come back to gene ENSMUSG00000057455


For any suggestions or comments, please send an email to unitrap@crg.es