Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_454A2-3
Clone ID CMHD-GT_454A2-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_454A2-3
Sequence
CATTCATTCTGTCGGAGAGCATAATAGAAGTCCTGCGCTTTGGCGACGGGGGGCTACTACAGACTGAGACAACACTTGGC
CTCGGTTCATACCAAATAAAAGAAAAAAGAAGAATGAAGGCTCTGCTCGGGTACTGCGCATTCTGCAGCGCATTGGCCAG
AAGAAAGCCCAGCTCATCGTGGGCTGGAGGGAGCTCCACGGCCCCTTCAGTGAGGTGGAGGACTTGGAACAGGTGGAAGG
CATCTCTGGGAAGCAGGTGGAGTCTTTCCTGAAGGCGAATCTCTTGAGCTTGGCCGCCAGCCAGCACAGCGGTCCCTCTT
GACACTACCTTCTTTTAAAAATCCTTGTATAGTGACGTGTTGTGTAAATACAGTTTTTATTGC
Sequence Type mRNA
Unitrap ID UNI17295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134171248..134171686 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030677 (Kif22) NM_145588 kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]

 
Come back to gene ENSMUSG00000030677


For any suggestions or comments, please send an email to unitrap@crg.es