Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_460A4-3
Clone ID CMHD-GT_460A4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_460A4-3
Sequence
TTTTCTCCGTCCCCACAAGCTTAAGATCCTGCTTCAGAGTATTCGAAAATATTACCCAGACATCACCGTGATTGTAGCTG
ATGACAGCAAGGAGCCCCTGGAAATTAATGATGACTACGTGGAGTACTACACCATGCCCTTTGGGAAGGGCTGGTTTGCT
GGGAGGAACCTGGCCATCTCACAGGTGACTACTAAATATGTCCTCTGGGTGGACGATGACTTTCTCTTCAGCGACAAGAC
CAAGATTGAGGTACTGGTGGATGTCCTGGAGAAAACCGAACTGGATGTGGTGGGTGGCAGCGTGCAGGGGAATACTTACC
AGTTCAGGCTGCTGTATGAACAGACCAAGAATGGGAGCTGTCTTCACCAGAGGTGGGGATCATTCCAGGCCCTTGACGGC
TTTCCCGGATGCACGTTGACCAGCGGCGTGGTGAACTTCTTCTTGGCTCACACGGAACAACTCCGAAGAGTTGGTTTTGA
TCCCATCTTGCAACGAGTGGCCCACGGAGAGTTCTTTATTGATGGGCTGGGGAGACTGTTGGTGGGCTCTTGCCCGGGTG
TAATTATAAACCACCAAGTAAGAACACCACCAAAGGATCCAAAGCTGGCTGCCTTGGAGAAGACTTATGACAAATACCGG
GCCAACACCAATTCTGTGATCCAATTCAAGGTTGCACTCCA
Sequence Type mRNA
Unitrap ID UNI37265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95727419..95730695 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013418 (B4galnt2) NM_008081 beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI (curated);Acc:B4galnt2-001]

 
Come back to gene ENSMUSG00000013418


For any suggestions or comments, please send an email to unitrap@crg.es