Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_459A10-3
Clone ID CMHD-GT_459A10-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_459A10-3
Sequence
TGTTTTGCCTGTGTGTATATATGTACACGTATGTACACCATGTCATGAGCCTCCATGGTCGTGAGAGGACTTTGGATCCC
TTGGAACTGGCGTTACATTGGTCGTGAGCCTCCATGTTGGCGCTGAGAAGCAAACCTGGGTTCTCTGGAAGCGCAGCAAG
TGCTCTTAACCATCGAGCCATCTCTCCATCTCAAACCACCCATGTATATAAAATGAAAATACATAAACC
Sequence Type mRNA
Unitrap ID UNI14032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77555188..77555416 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037857 (Nufip2) NM_001024205 nuclear fragile X mental retardation protein interacting protein 2 Gene [Source:MGI (curated);Acc:Nufip2-001]

 
Come back to gene ENSMUSG00000037857


For any suggestions or comments, please send an email to unitrap@crg.es