Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_421D7-3
Clone ID CMHD-GT_421D7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_421D7-3
Sequence
GGCTGAGAACTACTGGGTGGCGTGGGCAGAATACGCGGACCCTGTGTGTAGGACCCTTCCCTCGAAATGTCGTGACCTCC
GTGGCTGGCCTGTCAGCCCAGGACATCAGCCAGCCTCTACAGAATAGCTTCATTCACACAGGACATGGTGACAGTGACCC
CCGCCACTGCTGGGGGTTCCCTGACAGGATCGATGAACTGTACCTGGGAAACCCCATGGACCCTCCTGACCTGCTGAGTG
TGGAACTGAGCACCTCCACATTCCTGCTTGACCTGTGACTGCCGAGAAGGTATCCGATGTGTCCCCCTCCTCCTCCGGTG
ATCAACTCGTGGACCCAACTATGGATATCGGCTTCGACCGAACAAATAACGCGTGTTTCTATTTTATGATGAAAGAAACT
GAAGAAACCAACCCTGCCTCGAGGGCTGTGGCTGGCAAAGCCCTAAGCCCGAGTGCCAGGCACCAAGGCAGACCGCAGCA
GTGGGGGTGAGGTCACACTCATCGACTTCGGTGAGGAGCCTGTGGTCCCAACCCCTCGGCCCTGTGCACCCTCCTTGGCA
CAGTTGGCCATGAACGACCTGGTGTCCGAGTACCAGCAGTACCAGGACGCTACAGCTGAGGAAGAGGGAGAGTTTGAGGA
GGAGGCTGAGGAGGAGGTGGCTTAGAGCTGTCTTAGTCACTAAAGCATGGGAGCAGTGTGAACTCTTTATTCATTCACAG
CCTGTCTGCTAGCCATGTCCACTGTGCATTTGCTGTCCTGTGTCCTGAC
Sequence Type mRNA
Unitrap ID UNI25326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32675608..32679791 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022791 (Tnk2) NM_016788 tyrosine kinase, non-receptor, 2 Gene [Source:MGI (curated);Acc:Tnk2-002]

 
Come back to gene ENSMUSG00000022791


For any suggestions or comments, please send an email to unitrap@crg.es